Isolation and characterization acidithiobacill us ferrooxidans and a cidithiobacill us ferrivorans from the arsenopyrite flotation concentrate in Kazakhstan

Размещено на http://www.allbest.ru/

Isolation and characterization acidithiobacill us ferrooxidans and a cidithiobacill us ferrivorans from the arsenopyrite flotation concentrate in Kazakhstan

K. Shibayeva Introduction

Arsenic is a toxic metalloid which widely distributed in many environments and highly toxic to all life forms. It occurs primarily in inorganic form, as arsenate (AsV) and arsenite (AsIII)(1). It is found in the environment in a wide range of more than 200 mineral forms in soils in several forms of inorganic compounds, of which about 60% are arsenates, 20% sulfides and sulfosalts, the remaining 20% are arsenites, arsenides, silicates, oxides and elemental arsenic. Most of them are ore minerals or their alteration products. The greatest concentrations of these minerals can be found in mineralised areas which in close associated with the Cd, Pb, Ag, Au, Sb, P, W and Mo. The most abundant arsenic-containing ore minerals are arsenopyrite or mispickel (FeAsS), which contains 46% arsenic by mass, realgar (AsS), and orpiment (As2S3) (2) which are As(III) compounds that were formed under reducing, subsurface conditions. Arsenic has been presented in the Earth's crust in an average amount of about 2-5 mg/kg(3). The optimization of industrial heap bioleaching, mainly aimed recovery of copper and, K.N. Seitkamal1,2, N.K. Zhappar1, V.M. Shaikhutdinov1, U.Z. Sagyndykov2 1LLP "Scientific-analytical center "Biomedpreparat", Stepnogorsk, 3 microdistrict-9,Stepnogorsk, Akmolaregion, 021500, Kazakhstan;

Abstract

Seven arsenic resistant ferrous oxidizers were isolated from Aksu and Bestobe mine samples. The isolates are a rod-shaped, motile Gram-negative bacterium. Characterization of these isolates was done using standart microbiological, biochemical and phylogenetic comparative methods. The morphological, biochemical, physiological analysis based on 16S rRNA gene sequence showed that the strains 385A, 377B, 536B, 538J, 537C are most closely related to Acidithiobacillusferrivorans, the strains 383A and 393B identified as Acidithiobacillusferrooxidans and Acidithiobacillusferriphilus, respectively. The results showed, in the flask experiments all the seven isolates at 8mM of arsenic were able to oxidize ferrous iron to ferric iron. Isolate 383A showed high resistance to As concentration of 64mM. This is very promising results since, the native isolated strains especially strain 383A can be used in bioleaching and bioremoval of As processes.

Keywords: Bioleaching, Acidithiobacillusferrooxidans, Acidithiobacillusferrivorans, biooxidation of ferrous iron.

Аннотация

Из шахтной воды и руды рудных месторождений Аксу и Бестобе было выделено семь устойчивых к мышьяку железных окислителей. Изоляты представляют собой палочковидную, подвижную грамотрицательную бактерию. Характеристика этих изолятов проводилась с использованием стандартных микробиологических, биохимических и филогенетических сравнительных методов. Морфологический, биохимический, физиологический анализ, основанный на последовательности гена 16SрРНК, показал, что штаммы 385A, 377B, 536B, 538J, 537Cпринадлежат к виду Acidithiobacillusferrivorans,штаммы 383Aи 393B, идентифицированные как Acidithiobacillusferrooxidansи Acidithiobacillusferriphilus,соответственно. Результаты показали, что в экспериментах с колбами все семь изолятов при 8 мМ мышьяка были способны окислять двухвалентное железо в трехвалентное железо. Изолят 383А показал высокую устойчивость к концентрации As64 мМ. Это очень многообещающие результаты, поскольку природно выделенные штаммы, в особенности штамм 383А, могут быть использованы в процессах биологического выщелачивания и биовосстановленияAs.

Ключевые слова: биовыщелачивание, Acidithiobacillusferrooxidans, Acidithiobacillusferrivorans, биоокислениедвухвалентногожелеза.

Uranium, and stirred reactor processes for the recovery of precious metals such as gold and silver requires knowledge of the main types of microorganisms involved in bioleaching processes and associated with them. Furthermore, physiological and taxonomic characterization of microbial species involved in oxidative dissolution of sulfide mineral is also exceedingly important for comprehension disturbances in natural environments resulting from acid mine drainage(4,5). Since arsenic has been associated with gold ores, gold mining may contribute to arsenic pollution. Practically, gold mining activities are played as the key source of arsenic contamination in many regions(6).

Bioleaching is extraction of valuable metals from their ores using bacteria or their metabolites. The most familiar representatives of acidophilic bacteria used for bioleaching are mainly ferrous iron and/or sulfur oxidizing chemoautotrophs, such as Acidithiobacillus, Leptospirillum, Acidimicrobium, Sulfobacillus and Sulfolobus spp.(7), that derive energy by oxidization of ferrous iron and/or sulfur-containing minerals for growth(8). The genus Acidithiobacillus is a Gramnegative, chemoautotrophic microorganism that derive energy from the oxidation of reduced sulfur compounds. The mesophilic bioleaching bacteria A. ferrooxidans is considered the most widely studied and the most important microorganisms in the bioleaching of sulfide ores(9,10), nevertheless other sulfur or ferrous iron oxidizing bacteria might have significant roles in these processes(ll). Although it is found in many types of low pH natural environments in various geoclimatic zones, it is more commonly referred to in anthropogenic environments. The main reason of using A. ferrooxidans is its ability to utilize both ferrous iron (Fe²⁺⁾ and sulfur moieties in sulfide ores for growth. There are two mechanisms of solubilization metal ions from sulfide minerals: metal ions solubilized directly by A. ferrooxidans cells (the direct) and metal sulfides are chemically attacked by ferric iron produced by A. ferrooxidans cells (the indirect)(12,13). On the other hand, A. ferrivorans is the psychrotolerant bacteria that has the ability to oxidize ferrous iron with more efficiency than A. ferrooxidans at low temperature(14- 16). These a polyphyletic group of Gram-negative, rodshaped bacteria have been isolated from sulfur- containing mineral deposits(17)^,(18). Although these microorganisms have many common physiological features, A. ferrooxidans and A. ferrivorans vary in growth in low pH and temperatures, which suggests that the two microorganisms would tend to dominate a diverse environment. In addition to the function of metal oxidation and the production of sulfuric acid in the process of bioleaching, this microorganism also makes an important contribution to the biogeochemical cycle of metals and sulfur in the environments 9). The oxidation of arsenopyrite (FeAsS), depending on the oxidation conditions, leads to a number of products with different final sulfur and arsenic oxidation rates. Biological oxidation of arsenopyrite also results in the dissolution of the arsenic in the form of As(III) and generate As(V) in the medium(20).

In the present study, we described the isolation and characterization of the mesophilic and acidophilic iron oxidizing microorganisms of novel strains of A. ferrooxidans, A. ferriphilus and A. ferrivorans which were isolated from mine tailings from gold ores in Kazakhstan and studied its ability for oxidizing ferrous iron a t high concentration of arsenic.

Materials and methods

Sample

Culture media

9K-Fe modified solid medium and liquid medium(21) were used for enrichment and isolation of the sulfur-oxidizing microorganisms at a temperature of 28°C. The medium used for the isolation of iron-oxidizing bacteria of the genus Acidithiobacillusconsisted of the following basal salts (in grams per liter): KH2PO4 (3,0), MgSO4-7H2O (0,5), (NH4)2SO4 (3,0), KCl (0,1), Ca(NO3)2 (0,01), adjusted to pH 2.0 at room temperature using 10 N H2SO4 and autoclaved at 121 °C for 20 min; the medium also supplemented with filter-sterilized FeSO4-7H2O (44,2) were used for flasks enrichment and liquid culture.

Isolation and phenotypic characteristics

The cultures were isolated and purified on agar solid 9K medium. The agar plates were incubated at 28 °C for 12-14 days until microbial growth. Then single milky colonies were carefully selected and streak cultures on solid medium were repeated at least five times until a pure culture was obtained. The purity of the selected cultures was confirmed by a phase-contrast microscope. Isolated samples in an amount of 5 g were introduced into flasks with 100 ml of 9K medium to obtain accumulative cultures of mesophilic iron- oxidizing microorganisms. Growth experiments was carried out on a shaker-incubator at a temperature of 28 ° C at 200 rpm. Samples were removed for pH measurements and iron analysis. The presence and growth of microorganisms was recorded by indirect signs -- by the transition of ferrous iron (Fe²+) to its oxidized ferric iron form (Fe³+) and a decrease in the pH of the solution. Morphological properties of the isolates were investigated by under a phase-contrast microscopy (Standard 25 Carl Zeiss, Germany). The physiological and biochemical characterizations, tinctorial properties of the isolated pure cultures (the shape and size of cells, size, color, edge of the colonies, pH, temperature, growth characteristics on solid and liquid media) were studied in accordance with described in Bergey's Manual of Determinative Bacteria.

Screening and selection of microorganism strains and arsenic resistance

Arsenic resistance of the isolated bacteria was conducted using modified 9K-Fe where different concentration of As (III) (8-64 mM) was added. Cultivation was carried out in 750 mL Erlenmeyer flasks containing 180 mL of 9K at 28 ° C on rotary shaker at 200 rpm. Control experiments were also carried out with the arsenic-free media. Growth of the microorganisms were measured in terms of ferrous oxidation. Growth of the isolates was measured in terms of ferrous iron oxidation.

Chemical analysis

The pH and redox potential were measured using saturated calomel electrode (Mettler Toledo Seven Multi S47-K) while redox potential (Eh) was measured in terms of mV by combined platinum ring indicator and S7 screw head. The concentration of Fe³+and Fe²+ ions in the liquid phase was determined spectrophotometrically using a Biomate 3 spectrophotometer (Thermo Ficher Scientific). The elemental composition of the ore and concentrate was determined by atomic emission spectrometry on an iCAP 7200 ICP-OES Analyzer spectrometer from ThermoScientific.

Phylogenetic analysis of 16S rRNA genes

Genomic DNA of all the four iron oxidizers was isolated using pQIAamp DNA Mini Kit according to the manufacturer's protocol. The concentration of extracted DNA was measured on a NanoDrop 1000 (Thermo Scientific, USA). The 16S rRNA gene of the isolated strains were amplified by PCR using bacterial primers 8F (5' AGAGTTTGATCCTGGCTCAG 3') and 806 R (5' GGACTACCAGGGTATCTAAT 3') DNA Engine Tetrad 2 Cycler (Bio-Rad). The composition of the reaction mixture: 10 x dNTPs (2 mmol / l each) 2.5 pl, 10 x PCR buffer 2.5 pi, target DNA (0.04 pg / pl) 5 pl, Taq DNA polymerase 1U, 10 pmol primers 0, 5 pl. The total volume of the mixture was adjusted to 25 pl with nuclease-free water. Thermo Cycling procedure was as follow: pre-denaturation at 95 ° C for 5 min, followed denaturation at 95 ° C for 30 sec, annealing at 55 ° C for 40 sec and elongation at 72 ° C for 50 sec. Total PCR consisted of 30 cycles. The last elongation was carried out at 72 ° C for 7 min. The PCR products were analyzed by 2% agarose gel electrophoresis at 120V inlxTAE (0.04 M tris acetate and 0.001 M EDTA and 57.1 mL of glacial acetic acid, pH 8.0) buffer and the bands were visualized by ethidium bromide stained gel. The resulting PCR product was purified then screened and sequenced using BigDye terminator v3.1 sequencing kit (Applied Biosystems) on a 3730 DNA analyzer (Applied Biosystems, USA) according to the manufacturers' protocols. Sequences were analyzed and aligned using the Vector NTI Advance 10 software. Gene fragments were separated using an ABI 3730xl automatic sequencer (Applied Biosystems, USA).

The obtained 16S rRNA nucleotide sequences of the strains were compared with sequences of other microorganisms through the GenBank NCBI database and the phylogenetic trees were constructed by MEGA X software.

Results and discussion

Isolation of the strains

The arsenopyrite ores and wastes of a gold depositsBestobe and Aksu showed extreme environmental conditions in terms of pH and temperature. Four mine water samples and 13 ore samples were taken from ore deposits to isolate acidophilic thionic bacteria (Table 1). Isolates of samples of natural materials (ore, mine water) that were not processed to the technological process were used to isolate microorganisms and the pH of the samples was in the range of 4.0-6.5. The temperature of the samples was from 8 to 21 ° C. The presence of high content of sulfur and iron in the samples (Bestobe 1.09-1.48%, Aksu 0.42-0.93%) conducive to the development of chemolithotrophicmicroflora.The high arsenic content (Bestobe 0.16-0.32%; Aksu 0.10-0.23%) conducive the presence of microflora resistant to arsenic (Table 2-3).

Table 1

Physico-chemical characters of water samples and ore samples from ore deposits

In total, seven pure cultures were isolated from different samples of the 9K medium by sowing on silica gel plates saturated with 9K culture medium and numerous serial dilutions in the nutrient medium. Beige-colored colonies of accumulative crops 383, 385,537 (Aksu), 377, 393, 536, 538 (Bestobe), developed on the 9K-Fe-agarose plate after 5 days' incubation at 28 °C. These microorganisms were considered as efficient iron-oxidizing bacteria named as 385A, 383A, 377B, 393B, 536B, 538J, 537C1.

Table 2.

Results of a general chemical analysis of Bestobe deposits

Table 3.

Results of a general chemical analysis of Aksu deposits

Phenotypic characteristics The isolated strains were described by the same morphological and physiological characteristics (Table 4). Colonies of the isolates on solid 9K-Fe-agarose medium appeared flat, pasty, reddish-brown after 5 days' incubation (Fig.1. a). Microscopic observations of the isolated microorganisms showed that all the isolates are small, rod shaped, single or double cells and motile (Fig. 1. b). gene general chemical strain arsenic

Table 4.

Primary identification of isolates

Genotypic characteristics

The isolated strains were further identified by the partial nucleotide sequence of 16S rRNA. The determined partial nucleotides sequences of 16S rRNA were used to find the most similarity with the bacterial strains in the GenBank database. The results of molecular genetic analysis using sequencing analysis of 16S rRNA genes confirm the data obtained by studying the phenotypic characteristics of isolates and according to the nucleotide sequences of 16S rRNA strains 383A, 393B, 377B and 538J were most closely related to A. ferrooxidans ATCC 23270 (NR_074193) with 99.36%, A. ferriphilus strain M20 (NR_147744) with 100%, A. ferrivorans NO-37 (NR_114620) with 99% and A. ferrivoransNO-37 (NR 114620) with 100% similarity, respectively. The strains 385A, 536B and 537C1 closest relatives were A. ferrivorans strain NO-37 (NR_114620) with 99.31%, A. ferrivorans strain NO- 37 (NR_114620) with 99.83% and A. ferrivorans strain NO-37 (NR_114620) with 98.57% sequence similarity, respectively. Phylogenetic relationships based on 16S rRNA gene sequences are shown in Fig.2.

Figure. 1. Colony morphology of the strains. a: colonies on 9K-Fe solid medium; b: phase-contrast microscopy